End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression and target prediction. Use when analyzing miRNA, isomiR, tRF, or piRNA sequencing data through preprocessing, quantification, discovery, DE, and targets.
The English summary is being prepared. Showing the original description.
See how to installReview the instructions the agent will receive before you install.
Reference examples tested with: cutadapt 4.4+, miRDeep2 2.0.1.3+, miRge3.0 0.1.4+, DESeq2 1.42+
Before using code patterns, verify installed versions match. If versions differ:
packageVersion('<pkg>') then ?function_name to verify parameters<tool> --version then <tool> --help to confirm flagsIf code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Analyze my small RNA-seq data from FASTQ to differential miRNAs" -> Orchestrate adapter trimming (cutadapt), quantification (miRge3) or discovery (miRDeep2), differential expression (DESeq2), and target prediction (miRanda), with the small-RNA-specific decisions surfaced at each step.
FASTQ -> cutadapt trim -> miRge3 (known) / miRDeep2 (novel) -> DESeq2 -> target prediction
|
+-> tRF / piRNA profiling (MINTmap / unitas)
# The 3' adapter is on EVERY real read (insert ~22 nt << read length), so --discard-untrimmed
# drops adapter-dimer / no-insert junk - the inverse of genomic DNA. For NEXTflex 4N libraries,
# strip the random bases AFTER adapter removal (cutadapt -u 4 -u -4); for QIAseq UMIs, extract
# and dedup with umi_tools. Never position-dedup a non-UMI small-RNA library.
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
--minimum-length 18 --maximum-length 30 --discard-untrimmed \
-o trimmed.fastq.gz reads.fastq.gz
# Known-miRNA + isomiR quantification (the common case) - fast, curated libraries:
miRge3.0 annotate -s trimmed.fastq.gz -lib /path/to/miRge3_Lib -on human -db miRBase \
-a illumina -gff -ai -cpu 8 -o mirge_out
# OR novel discovery (high false-positive; needs a genome and bowtie 1):
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 -m -p genome_index \
-s reads_collapsed.fa -t reads_collapsed_vs_genome.arf
miRDeep2.pl reads_collapsed.fa genome.fa reads_collapsed_vs_genome.arf \
mature_ref.fa none hairpin_ref.fa -t Human
# Choose the miRDeep2 score cutoff from survey.pl signal-to-noise; it is not a fixed rule.
library(DESeq2)
# Feed RAW counts (miR.Counts.csv), NOT RPM. A few miRNAs can dominate the library, so
# inspect sizeFactors for compositional distortion before trusting the calls.
counts <- read.csv('mirge_out/miR.Counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(round(counts), colData, ~condition)
dds <- dds[rowSums(counts(dds)) >= 10, ] # lower prefilter than mRNA
dds <- DESeq(dds)
print(sizeFactors(dds))
res <- lfcShrink(dds, coef = 'condition_treated_vs_control', type = 'apeglm')
# Prediction is a hypothesis: intersect with anti-correlated mRNA DE before trusting targets.
miranda mature_mirnas.fa target_3utrs.fa -sc 140 -en -20 -strict -out targets.txt
No reviews yet. Tell others what you thought.
No login needed. Share how it worked for you, ask a question, or note where it did not run.
No comments yet. Be the first to write one.
Simplest distributed training API. 4 lines to add distributed support to any PyTorch script. Unified API for DeepSpeed/FSDP/Megatron/DDP. Automatic device placement, mixed precision (FP16/BF16/FP8). Interactive config, single launch command. HuggingFace ecosystem standard.
The English summary is being prepared. Showing the original description.
ADMET property prediction for drug candidates. Full pharmacokinetic panel (Caco-2, PPB, clearance, CYP), toxicity (hERG, AMES, DILI), drug-likeness (Lipinski, QED), using RDKit descriptors and TDC models.
The English summary is being prepared. Showing the original description.
Interpretable ADMET analysis with mechanistic reasoning. Maps liabilities to structural causes and biological pathways. Based on CoTox (Park 2025) and DrugR (Liu 2026).
The English summary is being prepared. Showing the original description.
This skill should be used for time series machine learning tasks including classification, regression, clustering, forecasting, anomaly detection, segmentation, and similarity search. Use when working with temporal data, sequential patterns, or time-indexed observations requiring specialized algorithms beyond standard ML approaches. Particularly suited for univariate and multivariate time series analysis with scikit-learn compatible APIs.
The English summary is being prepared. Showing the original description.
Infer gene regulatory networks (GRNs) from gene expression data using scalable algorithms (GRNBoost2, GENIE3). Use when analyzing transcriptomics data (bulk RNA-seq, single-cell RNA-seq) to identify transcription factor-target gene relationships and regulatory interactions. Supports distributed computation for large-scale datasets.
The English summary is being prepared. Showing the original description.
Comprehensive Python library for astronomy and astrophysics. This skill should be used when working with astronomical data including celestial coordinates, physical units, FITS files, cosmological calculations, time systems, tables, world coordinate systems (WCS), and astronomical data analysis. Use when tasks involve coordinate transformations, unit conversions, FITS file manipulation, cosmological distance calculations, time scale conversions, or astronomical data processing.
The English summary is being prepared. Showing the original description.